ژنتيکي، CVp ضريب تغييرات فنوتيپي، .. X?ميانگين هر صفت، MSg ميانگين مربعات ژنوتيپي، MSe ميانگين مربعات اشتباه آزمايشي، r تعداد تکرار در آزمايش مي‌باشند.

X?.. = ?X/ N
?2g = MSg-MSe/r
?2 e = MSe / r
?2 p = ?2g + ?2e
h2= ?2 g/ ?2 p
CVp = ?p/ X?
CVg= ?g/ X?

شدت تنش65 براي کليه صفات اندازهگيري شده، با استفاده از فرمول زير محاسبه گرديد:
SI=1-((Ys) ?/(Yp) ?)
= ميانگين وزن خشک يا عملکرد کليه ژنوتيپها در شرايط بدون تنش(Yp) ?
= ميانگين وزن خشک کليه ژنوتيپها در شرايط تنش(Ys) ?
شاخص تحمل به تنش2 نيز با فرمول زير بدست آمد (فرناندز3، 1992)
STI=(YP)×(YS)/ (Yp) ? 2

= وزن خشک يا عملکرد هر ژنوتيپ در شرايط بدون تنش YP
= وزن خشک هر ژنوتيپ در شرايط تنش YS
با رسم نمودار سهبعدي STI، YP و YSژنوتيپ‌هاي مناسب جهت کشت در شرايط بدون تنش (محلول هوگلند) و 10 دسي‌زيمنس بر متر (تنش) شناسايي شدند. جهت بررسي روابط فنوتيپي و ژنوتيپي بين صفات ظاهري، ضرايب همبستگي ژنوتيپي و فنوتيپي محاسبه شدند. ضريب همبستگي فنوتيپي با استفاده از ميانگين مشاهدات محاسبه شد. به منظور محاسبه ضريب همبستگي ژنتيکي از رابطه‌ زير استفاده شد.
Rg) x,y)= covg(x,y)/ (sx.sy)

در رابطه فوق covg نشان‌دهنده کوواريانس ژنتيکي دو صفت x و y، و sx و sy انحراف معيار ژنتيکي دو صفت مذکور مي‌باشند. کوواريانس ژنتيکي دو صفت با استفاده از اطلاعات حاصل از جدول تجزيه کواريانس طرح کاملاً تصادفي و با استفاده از اميد رياضي به کمک رابطه زير محاسبه شد (فرشادفر، 1377):
COVg= (spv/dfv – spe/dfe)/r
در اين رابطه 66spv مجموع حاصل ضرب‌هاي واريته و spe67مجموع حاصل ضرب‌هاي خطا مي‌باشند. dfv نشان‌دهنده درجه آزادي‌هاي واريته و dfe نشان‌دهنده درجه آزادي‌هاي خطا مي‌باشند و r نيز تعداد تکرار مي‌باشد.

3-6- آزمايش دوم: بررسي تنوع ژنتيکي به کمک نشانگرSSR
براي بررسي چندشکلي DNA بين ارقام مختلف سورگوم، 10 جفت آغازگر SSR روي 10 رقم مختلف سورگوم با خصوصيات متفاوت (جدول 3-1) مورد آزمايش قرار گرفتند. براي تهيه نمونه‌هاي برگي، از هر رقم 12 عدد بذر در گلدان کاشته ‌شد و پس از گذشت سه هفته نمونه‌هاي برگ گياهچه‌هاي جوان تهيه و به فريزر ??- درجهسانتيگراد منتقل گرديدند و تا زمان استخراج DNA در اين دما نگهداري ‌شدند. در اين آزمايش، استخراج DNA ژنومي با استفاده از روش CTAB تغييريافته انجام گرفت. ارزيابي کيفيت و کميت DNA استخراج شده با استفاده از الکتروفورز ژل آگارز (1 درصد) و قرائت با اسپکتروفتومتري صورت گرفت.

3-6- 1- استخراج DNA ژنومي از نمونه‌هاي گياهي مورد بررسي
استخراج DNA با استفاده از روش استخراج CTAB تغيير يافته بترتيب زير انجام گرفت:
ابتدا بافر استخراج به مدت 20 الي 30 دقيقه، درون حمام آب گرم (بن ماري) با دماي 65 درجه سانتي‌گراد گذاشته شد.
حدود 2/0 گرم از نمونه برگي را در هاون چيني قرار داده و در حضور ازت مايع سريعاً پودر شدند. پودر حاصله درون ميکروتيوب‌هاي 2 ميلي‌ليتري ريخته شدند.
800 ميکروليتر بافر استخراج به هر کدام از ميکروتيوب‌ها اضافه نموده و بعد از کمي مخلوط کردن با دستگاه ورتکس، در حمام آب گرم به مدت 65 دقيقه قرار داده شدند. در اين مدت هر 10 دقيقه يک بار به آرامي تکان داده شدند تا پودر گياهي بخوبي در بافر استخراج حل شده و تخريب سلول‌ها و استخراج DNA از پودر گياهي تسهيل گردد.
سپس به مدت چند ثانيه در دماي اتاق (دماي معمولي) قرار گرفتند و با دست به آرامي تکان داده ‌شدند.
800 ميکروليتر-کلروفرم ايزوآميل ( به ميکروتيوب‌ها اضافه کرده و بعد از کمي تکان دادن به مدت 10 دقيقه با سرعت 12000 دور در دقيقه و در درجه حرارت اتاق سانتريفيوژ شدند. در اين مرحله 3 فاز مجزا مشاهده شد که فاز بالايي به آرامي با استفاده از سمپلر 1 ميلي ليتري برداشته شد و مجدداً در ميکروتيوب‌هاي 2 ميلي‌ليتري ريخته شدند. اين مرحله دوباره تکرار گرديد و فاز بالايي درون ميکروتيوب‌هاي 5/1 ميلي ليتري ريخته شد. اين مرحله براي نمونه‌هايي که فاز بالايي شفافي نداشتند، تکرار گرديد.
5/0 و 6/0 ميلي‌ليتر از حجم فاز بالايي حاصل از مرحله قبل، به ترتيب آمونيوم استات 5/7% و ايزوپروپانول مطلق (100%) (نگهداري شده در فريزر 40- درجه سانتي‌گراد) به ميکروتيوب‌ها اضافه شد و به آرامي تکان داده شد تا امولسيون کاملي مشاهده گرديد. در پايان اين مرحله معمولا کلاف DNA قابل ديدن بودند، ولي براي تشکيل کلاف کامل، امولسيون حاصله به مدت 20 دقيقه در فريزر 40- درجه سانتي‌گراد نگهداري شدند.
بعد از گذشت 10 دقيقه اول (از 20 دقيقه‌اي که بايد در فريزر نگه‌داري شود)، سانتريفيوژ روشن شده و در دماي 4 درجه سانتي‌گراد تنظيم گرديد تا در انتهاي 20 دقيقه دماي سانتريفيوژ به 4 درجه برسد.
نمونه‌ها از فريزر بيرون آورده شده و با سرعت 10000 دور در دقيقه به مدت 10 دقيقه سانتريفيوژ شد و فاز مايع به آرامي خارج گرديد تا کلاف در ته لوله باقي بماند.
کلاف باقيمانده با استفاده از اتانول مطلق (96%) شستشو داده شد و با سرعت 9500 دور در دقيقه به مدت 1 دقيقه سانتريفيوژ شد و سپس مايع رويي را دور ريخته و لولهها در هواي آزاد به مدت 30 دقيقه نگهداري شدند تا الکل به طور کامل بخار شده و کلاف DNA خشک شود.
30 ميکروليتر آب دو بار تقطير به ميکروتيوب‌ها اضافه شد و براي حل شدن کلاف، ميکروتيوب‌ها تا زمان استفاده در يخچال 4 درجه سانتي‌گراد قرار داده شدند.

3-6-2- بررسي کميت و کيفيت DNA
3-6-2-1- بررسي کميت DNA به روش اسپکتروفتومتري
راحتترين روش بررسي کيفيت و غلظت DNA، استفاده از اسپکتروفتومتر است. حداکثر جذب نوري اسيدهاي نوکلئيک در طول موج 260 نانومتر است. روش کار به اين صورت بود که اگر اسيد نوکلئيک (DNA يا RNA) در بافر TE يا آب مقطر حل شده باشد، ابتدا با محلول TE يا آب مقطر به عنوان شاهد دستگاه صفر يا کاليبره مي‌شود. سپس
ميزان جذب نمونه خوانده مي‌شود. محلولي که نمونه در آن حل شده بايستي شفاف و يکنواخت باشد. بين غلظت DNA يا RNA و جذب نوري آن در 260 نانومتر رابطه زير وجود دارد:
جذب برابر با يک معادل 40 ميکروگرم در ميليليتر RNA يا DNA تک رشتهاي و 50 ميکروگرم در ميليليتر DNA دو رشتهاي ميباشد. شرط لازم در اين موارد، آن است که کيفيت DNA استخراج شده (نسبت جذب در طول موج 260 به جذب در طول موج 280 ) بين 8/1-6/1 ميکروگرم بر ميلي ليتر و کيفيت RNA استخراج شده بين 2-8/1 ميکروگرم در ميلي ليتر باشد.

3-6-2-2- الکتروفورز ژل آگارز با دستگاه الکتروفورز افقي
در اين تحقيق، جهت بررسي کيفيت DNA ژنومي از نظر شکستگي و قطعه قطعه شدن و بررسي DNA تکثير شده حاصل از PCR، از ژل آگارز 1 درصد استفاده شد. به اين منظور 1 گرم آگارز به 100 ميلي ليتر بافر TBE(1X)68 اضافه کرده و تا زمان حل شدن در ماکروويو قرار داده شد. تانک الکتروفورز، شانه و صفحه نگهدارنده ژل69 با آب مقطر استريل شسته شدند. دو وجه آزاد صفحه ژل مسدود شده و صفحه ژل در سطح صاف و تراز ثابت قرارداده شد. محل شانه در صفحه ژل تنظيم گرديد بطوريکه لبه پاييني شانه 1 ميليمتر از کف صفحه ژل فاصله داشته باشد. با توجه به حجم صفحه ژل، ميزان معيني از آگارز توزين و ژل مربوطه تهيه شد. زماني که ژل کمي خنک شد، درون صفحه ژل ريخته شد. بعد از سرد شدن و بستن ژل، شانه به آرامي بيرون کشيده شد. ژل درون تانک حاوي بافر TBE(1X) قرار گرفت. بايد توجه کرد بافر مشابه و هم غلظت بافري باشد که براي تهيه ژل استفاده شده است. بافر بايد حدود يک ميليمتر روي سطح ژل را بپوشاند. نمونهاي که با بافر بارگذاري70 مخلوط شده است، درون چاهکهاي ژل آگارز با دقت بارگذاري شد. محفظه پوشش تانک الکتروفورز بسته شده و جريان الکتريکي با ولتاژ 60 و به مدت 40 دقيقه برقرار گرديد.

3-7- PCR
براي انجام واکنشPCR ، از دستور العمل ويليامز71و همکاران (1990) با اندکي تغييرات استفاده شد. هر واکنش PCR شامل 25 ميکروليتر محتوي: 2 ميکروليتر DNA الگو با غلظت 50 نانوگرم تهيه شده، 5/1ميکروليتر MgCl2 با غلظت 50 ميلي‌مولار، 5/0 ميکروليتر dNTP با غلظت 10 ميلي‌مولار، 3/0 ميکروليتر آنزيمTaq DNA polymerase با غلظت lµunit/ 5، 2/1 ميکروليتر آغازگر با غلظت ppm 10، 5/2 ميکروليتر Buffer PCR داراي غلظت x10 و 18 ميکروليتر آب دو بار تقطير استريل بود. در اين تحقيق از تعداد 10 جفت آغازگر ساخته شده توسط از شرکت تکاپو زيست استفاده شد. آغازگرهاي SSR طبق فرمول مربوط به هر يک که شرکت توليدکننده روي هرکدام ذکر کرده رقيق شدند و در دماي 40- درجه سانتيگراد نگهداري شدند. آغازگرهاي مورد استفاده در اين پايان نامه با بررسيهاي انجام شده در بانک ژن و مرور مقالات بر اساس تعداد باندها، طراحي و انتخاب گرديدند (شيزاد72 و همکاران، 2009). جدول 3-4 اسامي آغازگرها و توالي آنها را نشان ميدهد.
براي انجام واکنش PCR ابتدا يک مخلوط اوليه73 از تمامي مواد PCR (به جز DNA) بر اساس تعداد واکنش ها با در نظر گرفتن يک کنترل منفي (بدون DNA) تهيه گرديد. تهيه مخلوط اوليه اين مزيت را دارد که موجب کاهش خطاهاي مربوط به پيپت نمودن حجم‌هاي کم مي‌شود. سپس آنزيمTaq DNA polymerase را اضافه کرده و به هم زده مي‌شود. پس از آن با تقسيم مخزن مخلوط ذخيره براساس تعداد نمونه مورد بررسي، تکثير PCR انجام مي‌شود.

جدول 3- 4: فهرست آغازگرهاي استفاده شده و توالي آنها
Size range
توالي آغازگر برگشت
توالي آغازگر رفت
نام آغازگر
280-320
GCGAAATTATTTTGAAATGGAGTTGA
AGCAAGAAGAAGGCAAGAAGAAGG
Xtxp270
160-245
TATTCATCGAGCAAAAGGCA
TATTTCCTCTTGAAAGAATCAGGG
Xtxp335
247-320
ACTCTACTCCTTCCGTCCACAT
GAAATTACAATGCTACCCCTAAAAGT
Xtxp274
180-240
ACC CAT TAT TGA CCG TTG AG
TCT CAA GGT TTG ATG GTT GG
Xtxp20
130-154
GCCTTTTTCTGAGCCTTGA
TGGGCAGGGTATCTAACTGA
Xtxp354
90-185
GTGAACTATTCGGAAGAAGTTTGGAGGAAA
CAGGAAAATACGATCCGTGCCAAGT
Xtxp312
170-280
AGTATAATAACATTTTGACACCCA
AACGGTTATTAGAGAGGGAGA
Xtxp331
330-360
AGTATAATAACATTTTGACACCCA
GCAAGCGAGCTGACTTATGTAACGAGA
Xtxp287
180-225
GCTTAGTGTGAGCGCTGACCAG
CACCAAGTGTCGCGAACTGAA
Xtxp258
205-260
TTGTCATTTCCCCCTTCTTTCTTTT
ATTTGATTCTTCTTGCTTTGCCTTGT
Xtxp285

3-7-1- الگوي دمايي
براي آغازگرهاي با دماي اتصال 56 تا 66 درجه سانتي‌گراد، برنامه PCR به‌صورت شيب حرارتي تنظيم گرديد (هکر 74و روکس، 1996). الگوي دمايي مورد استفاده در اين تحقيق در جدول3-5 آمده است. پس از اتمام واکنش، نمونه‌ها را از دستگاه خارج کرده و در فريزر در دماي 40- درجه سانتي‌گراد نگهداري شدند.

جدول 3-5- الگوي دماي PCR در آزمايش
سيکل‌ها
دما(°C)
زمان
تعداد سيکل
واسرشت سازي DNA
94
5 دقيقه

تک رشته‌اي شدن DNA
94
30 ثانيه

اتصال آغازگرها
66-56
60 ثانيه
35
گسترش رشته‌ها
72
45 ثانيه

تکميل گسترش رشته‌ها
72
7 دقيقه
1

3-7-2- امتيازبندي داده‌هاي مولکولي و تجزيه و تحليل‌هاي آماري آن‌ها:
الگوي نواري حاصل براساس وجود يا عدم وجود نوار به ترتيب، به صورت يک و صفر امتيازدهي75 شد. سپس بر اساس ماتريس صفر و يک، فاصله يا شباهت ژنتيکي بين افراد با استفاده از ضرايب مختلف محاسبه گرديد. مقدار عددي ضرايب تشابه بين صفر و يک است که مقدار صفر، بيانگر عدم وجود نوارهاي مشترک (عدم شباهت ژنتيکي) و مقدار يک، بيانگر الگوهاي نواري يکسان (تشابه ژنتيکي کامل) است.

دسته بندی : No category

دیدگاهتان را بنویسید